X Używamy plików cookie i zbieramy dane m.in. w celach statystycznych i personalizacji reklam. Jeśli nie wyrażasz na to zgody, więcej informacji i instrukcje znajdziesz » tutaj «.

Numer: 2917
Przesłano:

Proces translacji

1. Prowadzący: Renata Kabała
2. Typ zajęć: teoretyczne.
3. Przedmiot nauczania: biologia.
4. Temat zajęć: Proces translacji.

5. Cel ogólny: Uczeń potrafi scharakteryzować proces biosyntezy białka.

6. Cele operacyjne / kategoria celów / standardy egzaminacyjne:

• Uczeń potrafi zdefiniować pojęcia: translacja, kodon, antykodon, związek aminoacylo tRNA /A/I/4/a;
• Wymienić czynniki warunkujące przebieg translacji I/4/c;
• Omówić mechanizm działania translacji na podstawie schematu graficznego; C/I/4/a;
• Określić miejsce przebiegu translacji i syntezy kwasów rybonukleinowych B/I/4/c;
• Wskazać kodon, od którego rozpoczyna się proces biosyntezy białek; C/ II/1/b;
• Wskazać kodony kończące biosyntezę białek; C/ II/1/b;
• Ocenia znaczenie translacji w funkcjonowaniu organizmu człowieka; /D/ III/3/b

7. Metody kształcenia:
• Podające- objaśnienie lub wyjaśnienie;
• Programowane- na podstawie tekstu;
• Programowane-opis i pokaz z użyciem schematu graficznego;
• Problemowe – aktywizujące –dyskusja;

8. Forma zajęć: indywidualna praca ucznia.

9. Miejsce zajęć: sala szkolna ZS RCKU w Lidzbarku Warmińskim.
10. Czas: 45 minut
11. Data: 24.11.08
12. Podstawa programowa:
• Cele edukacyjne: 1.
1.Pogłębianie rozumienia postaw działania własnego organizmu w stosunku do wiedzy zdobyte w gimnazjum.
• Treści nauczania: 3.1
3. Elementy genetyki:
1) Budowa DNA, kod genetyczny, gen, synteza białek, genom człowieka;

I.Czynności porządkowe.
1. Zaprowadzenie ładu i porządku w klasie.
2. Sprawdzenie listy obecności.

czas: 3 min.

II. Sprawdzenie wiadomości z poprzedniego tematu
1. uczniowie piszą sprawdzian z trzech ostatnich lekcji- załącznik 2.

czas: 7 min.

III.Wprowadzenie do nowego tematu.

1. Nauczyciel zapisuje temat lekcji „ Proces translacji”
2. Uczniowie zapisują punkty do tematu lekcji:
2.1 definicje : translacja, kodon, antykodon, aminoacylo tRNA;
2.2. Czynniki warunkujące przebieg translacji;
2.3 Mechanizm działania translacji;
3. Nawiązanie do tematu
a) nauczyciel wyjaśnia uczniom pojęcie: translacja;
b) nauczyciel zadaje uczniom pytania
proszę powiedzieć:
-w jakich strukturach zachodzi synteza białka?;
-w jakim elemencie komórki zachodzi synteza białka?;
- z jakiego kwasu zbudowane są rybosomy?;
- jaka jest funkcja m RNA i t RNA?;
- co to jest kodon?;
jaką strukturę przestrzenną posiada m RNA?;
4 Nauczyciel wyjaśnia uczniom definicje: antykodon, aminoacylo tRNA oraz opisuję strukturę przestrzenną kwasu t RNA.;

czas: 10 min

metody: Objaśnienie,dyskusja

IV. Realizacja tematu
1. Nauczyciel omawia proces biosyntezy białka na podstawie (manualnego) schematu graficznego wykonanego przez uczennicę.

czas: 10 min
metody: Opis i pokaz

V. Ewaluacja

1. Nauczyciel zadaje uczniom pytania związane z procesem translacji w celu utrwalenia wiadomości zdobytych na lekcji;
2. wybrany uczeń omówi proces translacji przy schemacie manualnym przedstawiającym biosyntezę bialek
3. Mierzenie wiadomości zdobytych przez uczniów na lekcji. Przeprowadzenie testu Prawda- Fałsz( ZAŁ 1) – jeżeli czas pozwoli.
4. Wspólne ustalenie prawidłowych odpowiedzi.

czas: 15 min

metody:Pogadanka;

Załącznik 1

1.biosynteza białek zachodzi w jądrze komórkowym; P F
2.antykodon to trójka nukleotydów zawartych w kwasie t RNA; P F
3.proces biosyntezy białek rozpoczyna się od fenyloalaniny; P F
4.proces biosyntezy rozpoczyna się w miejscu określonym jako P; P F
5.pomiędzy dwie podjednostki rybosomu wsuwa się kwas rRNA; P F
6.zakończenie procesu translacji wyznaczają kodony nonsensowe; P F
7.funkcją kwasu t RNA jest przenoszenie aminokwasów do miejca syntezy białkaPF
8.AUG to kodon mówiący STOP syntezie białka; P F

Załącznik 2

Test I

Zad 1. (3 pkt)
a) Do podanego niżej pojedynczego łańcucha DNA przypisz drugi łańcuch
komplementarny uwzględniając wiązania.
b) Jak nazywamy powyższy proces.

AATCCGTGTAGACAGTTGCACATTA

Zad 2 (2 pkt)
Co oznacza, że kod genetyczny jest zdegradowany i kolinearny.

Zad 3 (1 pkt)
Wyjaśnij definicję: egzon.

Test II

Zad 1. (3 pkt)
a) Do podanego niżej matrycowego łańcucha DNA przypisz komplementarny łańcuch kwasu m RNA uwzględniając wiązania.
a) Jak nazywamy powyższy proces.

ATACATATCGAGCATACTAGAATCATT

Zad 2 (2 pkt)
Co oznacza, że kod genetyczny jest uniwersalny i jednoznaczny.

Zad 3 (1 pkt)
Wyjaśnij definicję: kodon.

O nas | Reklama | Kontakt
Redakcja serwisu nie ponosi odpowiedzialności za treść publikacji, ogłoszeń oraz reklam.
Copyright © 2002-2019 Edux.pl
| Polityka prywatności | Wszystkie prawa zastrzeżone.
Prawa autorskie do publikacji posiadają autorzy tekstów.